KEGG   Acidovorax avenae: Acav_R0032Help
Entry
Acav_R0032        tRNA      T01445                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  
tRNA Asn
Organism
aaa  Acidovorax avenae
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:aaa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Acav_R0032
Non-coding RNAs [BR:aaa03100]
 Transfer RNA
  tRNA
   Acav_R0032
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2429751..2429826)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tcctcgatagctcagtcggtagagcgccggactgttaatccgtaggtccctggttcgagc
ccaggtcgaggagcca

DBGET integrated database retrieval system