KEGG   Aquifex aeolicus: aq_184Help
Entry
aq_184            gene      T00013                                 

Definition
pseudogene
Organism
aae  Aquifex aeolicus
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
complement(113515..114164)
Genome map
NT seq 650 nt NT seq  +upstreamnt  +downstreamnt
atgggaaatttattcgtgctttccgcaccctcgggaactggaaaaacgacggtagcacag
aaattgctctccgaagtctccgacctcaagaggatagttacctacaccacgagaagtccc
cgcccctacgaacaaaacgagtagactacgtattcgtttccgtagaagaatttgagaaga
agataaaggaaggcttcttcctcgagtacgcgaacgtttacggaaattactatgggacgc
cgaagaaggacatagaggaaaccataaacgtagagaaaaaggacgcgctccttatcatag
acgtccagggtgcctttaaagtgaagaagttcttccccgaagccgttaccattttcctcc
tccctccctcctttgaagaacttaagaggaggattgaaggaagaggttacgtagattcca
acgtaagcaagaggcttgaaacagctaaaggagaggttccctgtgcaaggtttttcgatt
acatagttataaacgactacttgaacgaagcggtagaaaaggtaaaatctataattctct
cttacagagtgaagaaggagagagtcctggatgagatagagaagttcaggctcgataagg
atatcgtagatttactcaaaggaggtgagtgttatgtcaaggagacctaa

DBGET integrated database retrieval system