KEGG   Paenarthrobacter aurescens: AAur_0818Help
Entry
AAur_0818         gene      T00447                                 

Definition
(GenBank) pseudogene
Organism
aau  Paenarthrobacter aurescens
SSDB OrthologParalogGene clusterGFIT
Position
complement(853436..854080)
Genome map
NT seq 645 nt NT seq  +upstreamnt  +downstreamnt
atgagcaccaccgagccgctcccttccgcaaccgactccggcctgtcggagaagaaactc
cgcccgggccgcaccaacgccaccaagcagcgcctgttcgaggcttccatggagctgatc
ggcgagcgcggcgctgcgggggtgaccgtggatgaaattgcggccgccgccggggtgtcc
aagggaactgtctactacaacttcggcagcaaatccgatctgatcgcgcaattgctgcgg
cacggtgtggacatcatgctggtgcggctgcaggacgttcggggtaatagcagtgatccg
ctggaatccatgaacaacatggtgggacaggccatggagttcatggacgactacccctcc
ttcgcccgcctgtgggtcagtgaaaactggcgcactcccggcgagtggagtgccgtattt
gccgagctccgggctgaacttctggctgtgatcggctcggctgtggagagcgttgcgtcc
ggctacaaggttgatcagagcattgcccgaggctctttggaagcagcgattttcggggcc
atcttcgtggtgggcctcgaccggcagacgtacaaccctgaacgcactcgcgagcagagc
gtggcagctgtgatgaccatcatgcatgggtacgtcatcaagtag

DBGET integrated database retrieval system