KEGG   Acinetobacter baumannii ACICU: ACICU_tRNA42Help
Entry
ACICU_tRNA42      tRNA      T00710                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
abc  Acinetobacter baumannii ACICU
Pathway
abc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:abc00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    ACICU_tRNA42
Non-coding RNAs [BR:abc03100]
 Transfer RNA
  tRNA
   ACICU_tRNA42
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
3097506..3097591
Genome map
NT seq 86 nt NT seq  +upstreamnt  +downstreamnt
gcccgggtggtgaaataggtagacacaggggatttaaaatcccccgccctcaaagcgtgc
cggttcgagtccggccccgggcacca

DBGET integrated database retrieval system