KEGG   Acinetobacter baumannii ACICU: ACICU_tRNA43Help
Entry
ACICU_tRNA43      tRNA      T00710                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  
tRNA Leu
Organism
abc  Acinetobacter baumannii ACICU
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:abc00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    ACICU_tRNA43
Non-coding RNAs [BR:abc03100]
 Transfer RNA
  tRNA
   ACICU_tRNA43
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
3099654..3099739
Genome map
NT seq 86 nt NT seq  +upstreamnt  +downstreamnt
gcccgggtggtgaaataggtagacacaggggatttaaaatcccccgccctcaaagcgtgc
cggttcgagtccggccccgggcacca

DBGET integrated database retrieval system