KEGG   Asticcacaulis excentricus: Astex_0744Help
Entry
Astex_0744        CDS       T01378                                 

Definition
(GenBank) Uroporphyrinogen III synthase HEM4
  KO
K01719  uroporphyrinogen-III synthase [EC:4.2.1.75]
Organism
aex  Asticcacaulis excentricus
Pathway
aex00860  Porphyrin and chlorophyll metabolism
aex01100  Metabolic pathways
aex01110  Biosynthesis of secondary metabolites
aex01120  Microbial metabolism in diverse environments
Brite
KEGG Orthology (KO) [BR:aex00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00860 Porphyrin and chlorophyll metabolism
    Astex_0744
Enzymes [BR:aex01000]
 4. Lyases
  4.2  Carbon-oxygen lyases
   4.2.1  Hydro-lyases
    4.2.1.75  uroporphyrinogen-III synthase
     Astex_0744
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: HEM4 Glyco_transf_4 ATPgrasp_YheCD
Motif
Other DBs
NCBI-ProteinID: ADU12429
JGI: Astex_0744
UniProt: E8RKE9
Position
1:complement(795325..796008)
Genome map
AA seq 227 aa AA seqDB search
MSKLIWITRTEPQASVTAQALRARGFDVVNDPLLEVEYCSPDIDVARFPHIVATSINGLK
AFTRQYATRHQTVWTVGDATAREAREAGFVTVHSAGGDVEDLIRLLKSEAPQGPLLYPQP
ETPARDLSMALSGFDLHPVLFYRTVERDARDARAQRAAITHILLYSPRGAQACAPYLAGM
SARVLCISEATAQRLREHLNFTGNLPSAGLNIEVVASPDEEALFARL
NT seq 684 nt NT seq  +upstreamnt  +downstreamnt
gtgagcaaattgatatggattacccgaacggagccgcaggccagcgtcacggcgcaggcg
ctgcgggcgcggggctttgatgtggttaatgacccgctactcgaagtggaatactgcagc
cctgacatcgatgtggcgcgttttccccatatcgtcgccacctcgatcaatggcctgaaa
gcctttacgcgccagtacgcaacgcggcatcagacggtgtggactgtcggcgacgccacc
gcccgcgaagcgcgtgaggctgggttcgtcaccgtgcatagtgccggtggcgatgtcgaa
gacctgatccgactgctgaagtccgaggccccgcaaggcccactcctctacccgcagccc
gaaaccccggcgcgcgacctgagtatggcactatcgggtttcgacctgcatccggtcctc
ttttatcgcaccgtggagcgcgacgcccgcgacgcccgagcgcagagggcggctattacc
catatcctgctatattcgccgcgcggcgcgcaggcctgcgcgccctatctggcgggtatg
tcagcgcgcgtcctctgcatctctgaggccaccgcccaacggttgcgcgaacacctcaat
ttcactggaaatttaccctctgcgggcctaaacatagaggtagtggcctctccggatgaa
gaggccctgttcgccaggctctaa

DBGET integrated database retrieval system