KEGG   Acidithiobacillus ferrooxidans ATCC 53993: Lferr_2782Help
Entry
Lferr_2782        gene      T00758                                 

Definition
(GenBank) pseudogene
Organism
afe  Acidithiobacillus ferrooxidans ATCC 53993
SSDB OrthologParalogGene clusterGFIT
Position
2761313..2761762
Genome map
NT seq 450 nt NT seq  +upstreamnt  +downstreamnt
atccattacatctctatcggagtagatcgcaaacacaaactgatccgcaagctggtgacc
gacacggcctctgtccacgacagccggcactttgaagttgtactggatgactggaatacc
agtgccgaagtgtatgcggatagaggctaccccagtcaggagcgggaagaacaactcaag
gcccaaggctaccggagtcgtatccaacggaaaggcagccgcaaccacccactgtccgaa
tgccaacagcggcgcaaccataaaatcgccaaagtgcgggcgcgcgtagaacatgtattc
ggcaccatggagcagatgggcggcaagtgtatccggaccataggccaggcgcgggccgac
tttgcgctgaccatgatggcggttacctacaacatcaagcgactggggtttctcgaagta
ggtcctatgagggcggtggcttgcccgtaa

DBGET integrated database retrieval system