KEGG   Acidithiobacillus ferrooxidans ATCC 53993: Lferr_2783Help
Entry
Lferr_2783        gene      T00758                                 

Definition
(GenBank) pseudogene
Organism
afe  Acidithiobacillus ferrooxidans ATCC 53993
SSDB OrthologParalogGene clusterGFIT
Position
2761871..2762230
Genome map
NT seq 360 nt NT seq  +upstreamnt  +downstreamnt
gtttttagaggtgcccagtggtatgcctactcggatcctggcatggaagaagccctctac
gagatcccgctgctgcggcgattcgtgggtgtcgatcttggccgggactttgttcccgat
gaaacgaccatcctgaaatttcgtcgtctgctggagcggcacgacctggcgcgcgcgatc
ttcgaggaagtacaggtcgtcctgcgggagaaaggcttgctgctcgccgaaggcaggatg
gtggacgccaccctgatccatgcgccgagttccaccaaaaaccgggaacggaaacgggac
ccggagatgagctcgacgaaaaaggggaatcagtggtacttcgggatgaaggcccatgtg

DBGET integrated database retrieval system