KEGG   Acidithiobacillus ferrooxidans ATCC 53993: Lferr_R0050Help
Entry
Lferr_R0050       tRNA      T00758                                 

Definition
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
afe  Acidithiobacillus ferrooxidans ATCC 53993
Pathway
afe00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:afe00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Lferr_R0050
Non-coding RNAs [BR:afe03100]
 Transfer RNA
  tRNA
   Lferr_R0050
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(2669429..2669504)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggggctgtagctcagttgggagagcacctgctttgcaagcagggggtcaccggttcgaga
ccggtcagctccacca

DBGET integrated database retrieval system