KEGG   Ashbya gossypii (Eremothecium gossypii): AGOS_ADR274CHelp
Entry
AGOS_ADR274C      CDS       T00167                                 

Definition
(RefSeq) ADR274Cp
Organism
ago  Ashbya gossypii (Eremothecium gossypii)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
IV:complement(1170903..1172987)
Genome map
AA seq 694 aa AA seqDB search
MEALLAVEETGNDLWKELKELYWAQYVQNSVDKVQFERYVRKVKSADDYWLVRALLAFSD
SRKACTFNSRFEWLTMQAHGRQYPPLASKDAGKLIWNARREFRYAEPQQAAYKQLARPRG
DAVADIQQHPDLGNCSMVCALINVKRTCGTADMVADCGDVAQVNLFFNGARRLVTLHRAE
VRQNMRREQLAVLSPDMHDKLIEQAYFEVAHGMNYESMGSNTAMDTYMLCGWFPLVVETS
EVDFPFVQRYLARGAMLALGTHATRTIDSFCLRKNHDYAVLDVCGTVFRIRDPLVAGNVI
ELAWEDVRTAFHLLYINWDAHTQCQLYEKFHFRYNSAVHNRFMSWLNKPTYRVVNDTESE
LPVYALFERHLSNRKYDNSIVGVISGENLVSDTEEGNNIGMQWVELTVPPHSSRILFYHS
NTNTNCTLHLFSNSPRLKVAKWSSAESSRLAVLDGCWQPISKNLTFTHWPAFKFEIKHPE
TDGVHVSLQFCWANEHSAALFIYHASDYRYEKPLLHRPGPLPFPQAFFELALDTNTPYVV
LCQSMDVGADAAFQLAIQTEKQGSVISTVPTSRAYGGLRFHTSKLVSTAAKRIELPFKVS
RSTDLHITLYSKSSPLVLKCAVFSDGSDEAITATPGFVPINDYPYVLPITFAKERSLVLL
IELQDTVPDSTVTIEIGSNCAFNFCGHDVDLARV
NT seq 2085 nt NT seq  +upstreamnt  +downstreamnt
atggaagcacttttggctgtggaagaaacggggaacgacctatggaaggagcttaaggaa
ctatactgggcacaatacgtccagaacagcgtggacaaggtgcaattcgagagatatgtc
cggaaggtgaagtctgctgatgattactggctggtgcgggctctgctggcgttctcagat
agtaggaaggcgtgtacgttcaactctaggttcgaatggctcacgatgcaggcgcacggt
cggcagtatccgccgctcgcttcgaaggacgcgggcaagttgatctggaacgcacggagg
gagttcaggtatgcggagccgcagcaggcagcgtacaagcagcttgcgcggccgcgggga
gacgcagtggcagatattcagcagcatccggacctgggcaactgctcaatggtgtgcgcg
ctgataaatgtgaaacgtacgtgtggaacagcggacatggtcgcagattgcggtgatgtg
gcccaggtgaacctgttcttcaacggcgctcgcaggcttgtcacgctgcacagggcagag
gtacgccagaacatgcgccgtgagcagctggcagtgctgagccccgatatgcatgacaag
ctgatagagcaggcgtactttgaggttgcacacgggatgaactacgagtctatgggttcc
aacaccgccatggacacatatatgctatgtggctggttcccgcttgtggtggagacctct
gaggtagactttccgtttgtacagaggtatctcgcacgtggtgcgatgctggcgctcggg
actcatgcgacgcgcactatagactccttctgtcttcggaagaaccacgactacgcggtc
cttgacgtctgcggcacggtttttcgcatccgagatcctctggttgctgggaacgttatc
gagctagcttgggaagacgtccggactgcgtttcaccttctctacattaactgggacgct
catactcagtgccaactgtacgaaaagtttcacttccgttataatagcgctgtgcacaat
cgcttcatgtcgtggctgaacaagccgacatacagggttgtcaacgataccgagtccgag
ttgccggtatatgcgctgtttgagcgtcacctctccaaccggaagtacgacaattccata
gtaggtgtgatctcgggggaaaacctcgtttctgacactgaggaaggtaacaacataggt
atgcagtgggtggaactcacggttcctccgcactcgagcaggattctcttctaccacagc
aacaccaacaccaattgtaccttgcacctcttctcaaactctcctagactcaaagtcgcc
aagtggagcagcgcggagtcgtcgcgccttgcagtgctggacggctgctggcagcctatt
tcaaaaaacctcacgtttacccactggcccgcattcaagttcgagatcaagcacccggag
acagacggcgtccatgtctcgttacagttttgctgggccaatgagcattcggcggctctg
ttcatctaccatgcttccgactaccgctacgagaaacctctcttgcatcgtcctggccca
ctacctttcccacaggccttcttcgaactagccctcgacaccaatacgccgtacgtggtt
ttatgtcagtcaatggacgtcggcgcggatgcagcctttcagctggccatccaaaccgaa
aagcaaggctccgtcatatctactgtccctacctcgcgtgcttatggcggcttgcgcttc
cacacctcgaagcttgtctctacagcggccaagcgcattgagcttccattcaaagtctcg
cgctctacagatctgcatattacgctctactccaaatctagtcccctggtcctgaaatgc
gcagtcttcagtgacgggtcggacgaggccatcactgcgacgccaggttttgtcccaatt
aatgactacccatatgttctccctatcactttcgcaaaggaaaggtctctagtgctgctt
atagaactccaggacactgttcctgactccacagttacaattgagataggttcaaactgc
gccttcaacttctgcggccatgacgttgatctagctcgggtgtaa

DBGET integrated database retrieval system