KEGG   Apis mellifera (honey bee): 727168Help
Entry
727168            misc_RNA  T01057                                 

Gene name
GB12103
Definition
1,4-alpha-glucan-branching enzyme-like
Organism
ame  Apis mellifera (honey bee)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
BEEBASE: 
Position
Un
NT seq 1607 nt NT seq  +upstreamnt  +downstreamnt
tattaagtgatatatatattntcatttaggtttataaatttaaatattccaaacagaaaa
aaccaaaaagtcttagaatttatgaatgtcatgttggtattgcaactcaggaattaaaaa
ttggcacatatctagaatttgctaaaaacataatacctcgtattgtaaaacaaggctata
atgctatacaattaatggctatcatggaacatgcttattatgctagttttggatatcagg
taacttcattttatgctgcttcatctcgttatggtacaccagaagaattaaaactattga
tagatacagcgcatcaatatggtttatatgttttattagatgtggtacattcacatgcat
caaagaatactttagatggtttaaatatgtttgatggtactgatggttgttttttccatt
ctggcaatcgtggtcatcatccactgtgggatagtagactttttaattatggagaatatg
aagtattacgatttctactttccaatttacgttggtacattgaggaatataattaatttg
atggatttagatttgatggagttacatcaatgttgtatcattcaagaggatttggacaag
gttttacaggtcattatgaagaatattatggacttaatgttgatgttgaaggtgtagttt
atttaatgcttgcaaactatattttgcattatttatatccaaatatgattaccatagcag
aggatgttagtggaatgcctggagtttgcaggccaattactgaaggtggtttaggctttg
attatcgtttagccatggctattcctgataaatggattaaacttttaaaagaaataaaag
atgaagattggaatgttggggatatttgttggacattaactaatcgaagatggatggaga
aaacagtagcttattcagaatctcatgatcaagctcttgtaggtgataaaacaattgcat
tttggcttatggataaagaaatgtattttcatatgagtacactaagtccacctaatgcaa
ttataaatcgtgggattgctcttcataatctgattacattaatcacacatgcattaggag
gtgaagcttatttaaattttatgggtaatgaatttggtcatcctgaatggttggattttc
cacgagctggtaatgcagatagttatcattatgctagaagacaatggaatttagtagatg
atgaattacttaaatacaaatttatgaataattgggatcgggctgtaaatactcttgaag
caaaatatggatggctacatgctgaacctggatatataagtttgaaacatgaagaagata
aaataattgtttttgatcgtgcagaacttatatttgtttttaattttcatccaatcaaat
catttcctgattatactattggtgtaaaaagtgcaggaacttataaaattcttttgtgta
gcgatgataaaaattttggtggagaaaaccgtgttgatactaatatacaacattttacca
aaccagaatctttttctgattattcaaatagtatgatgatttacattccttgtcgcacag
ctattatttatattcgagaggaactttaatacttttaagaggcatag

DBGET integrated database retrieval system