KEGG   Acetobacter pasteurianus 386B: APA386B_588Help
Entry
APA386B_588       CDS       T02786                                 

Gene name
ppc
Definition
phosphoenolpyruvate carboxylase (EC:4.1.1.31)
Orthology
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
apk  Acetobacter pasteurianus 386B
Pathway
Pyruvate metabolism
Methane metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Brite
KEGG Orthology (KO) [BR:apk00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    APA386B_588 (ppc)
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    APA386B_588 (ppc)
  Energy metabolism
   00680 Methane metabolism
    APA386B_588 (ppc)
Enzymes [BR:apk01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     APA386B_588 (ppc)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
598008..598892
Genome map
AA seq 294 aa AA seqDB search
MKKLVEDPGYAALLGAFGPSLIDRTGSRPPARQSAESATHKRITHPSQLRAIPNNAILQQ
LGWCANTLQGLGAAVRRHPETFETFRTSSPRFHRALDFAQHGLSCSDDKVLKSVVCLLDP
GFWLDRATEEKTPARRKAFLSLMQDLEKLDLSAELLTMFRRIQADHLALREAWEHAPRTE
PQIRLLHAIRIMLIEQIWLLACRVPFFMPRGGFNHDVMMQHILCLDIPAVLEELEHIFPT
GTGPTNLDFHEPRGPREEGIYEREHRDIFVPMQRMFELIREISVAIMHNIGAFG
NT seq 885 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaactggtggaagaccccggttatgctgcgctgctgggcgcttttggaccatcc
cttattgatagaaccggctctcgtccccctgctcgccaaagtgcagaaagtgccacccac
aagcgcattacccaccccagtcagctacgcgccatccctaacaacgcaattcttcagcag
ctcggatggtgcgccaacaccttgcagggcttgggggcagccgtacgccgccacccggaa
acctttgaaacattccgcacatccagcccgcgctttcatcgtgctctggattttgcccag
catggcctgagctgctcggatgataaggtgctgaaaagcgttgtctgtttgctagacccc
ggcttctggctcgaccgcgccacagaggaaaaaacaccagcacgccggaaggcttttctc
tccctgatgcaggatctggaaaaacttgatctgtctgccgaactgctcaccatgttccgc
cgtattcaggccgaccatcttgcgttgagagaagcgtgggaacatgcaccgcgcacggaa
ccacagatccggcttctacacgccattcgtattatgcttattgagcagatatggctgctg
gcatgccgtgtgcccttcttcatgccacgtggcggctttaaccatgatgtcatgatgcag
cacatactgtgtctggatattcccgcagtgttggaagagcttgagcatatcttccccacc
ggcacgggcccaaccaaccttgattttcatgaaccacgtggcccgcgcgaagaaggtatt
tacgagcgagagcacagagacatctttgtacccatgcaacggatgtttgaacttattcgt
gaaatcagcgtcgccatcatgcacaatattggcgcttttggctga

DBGET integrated database retrieval system