KEGG   Amphimedon queenslandica (sponge): 100640653Help
Entry
100640653         CDS       T02284                                 

Definition
(RefSeq) mRNA export factor-like
  KO
K14298  
mRNA export factor
Organism
aqu  Amphimedon queenslandica (sponge)
Pathway
RNA transport
Brite
KEGG Orthology (KO) [BR:aqu00001]
 Genetic Information Processing
  Translation
   03013 RNA transport
    100640653
Messenger RNA biogenesis [BR:aqu03019]
 Eukaryotic Type
  mRNA surveillance and transport factors
   Transport factors
    Nuclear pore complex
     100640653
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
Position
Un
AA seq 147 aa AA seqDB search
MLQRVERLSASGNKLPHHIKGTGNKVVQTKDNFTFKCHRSVVTTAGQTQDIFAVNDIAFH
PTHGTLATVGSDGRYYFWDKDARTKLKHSEAMDQPITSCCFNHSGLVFAYAVSYDWSKGH
EHYNPAKKNYIFLRQANEDLRPRTKKR
NT seq 444 nt NT seq  +upstreamnt  +downstreamnt
atgttgcagagagtagagagactctcagcttctggcaacaagttgcctcaccacatcaaa
ggtactggcaacaaagttgttcaaactaaggataatttcacttttaaatgtcatcgctct
gtggtaactacagctggacagactcaagacattttcgctgtaaacgatatagcatttcac
cctactcatgggactctggctacagttggctcggatggtagatattatttctgggacaaa
gacgctaggacaaaattgaaacattctgaagctatggatcagccaataacgtcttgttgt
ttcaatcacagtggacttgtatttgcatacgctgttagttatgactggtcgaagggccac
gagcactataatcccgccaaaaagaattacatatttttgcgtcaggcaaacgaagattta
agacctcgtaccaaaaaacgttaa

DBGET integrated database retrieval system