KEGG   Actinoplanes sp. SE50/110: ACPL_7092Help
Entry
ACPL_7092         CDS       T02044                                 

Definition
(GenBank) Translation initiation factor IF-2
Organism
ase  Actinoplanes sp. SE50/110
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AEV87972
UniProt: G8SGT2
Position
7831446..7832354
Genome map
AA seq 302 aa AA seqDB search
MSQDPYPGQPFPGVPNPNVPPQEGLPPTQPFPGAYPQPQQPAYGQQPPPYGQQQPAYGQQ
PPAYGQQQPAYGQPAYGQPQPSFPPIPPAPKKSKALPITLISIAIVLVLCVGGVVAINLL
AKDDKSKGTATATSTSSTKATEGGAAKPAADITVVEPKTLGGRPKLTTAEFATITKTMQE
GLKDGYPGATKSLGAFYGTPVKKNMVMTIAVAAPISDPELELDRNFTSMSTTGFSAEHIT
AVDTGSFGGSAKCGDGKVSSVPVAVCAWSDSGSVGMLVWYYTSKSAAEKQFPAIRAEIEK
VG
NT seq 909 nt NT seq  +upstreamnt  +downstreamnt
atgtcgcaggacccctacccgggccagccgttccccggcgtgcccaacccgaacgtgccg
ccccaggaggggttgccgccgacccagccgttcccgggcgcctacccgcagccccagcag
ccggcctacggccagcagccgccgccctatgggcagcagcagccggcttacggccagcag
ccgcccgcctacggtcagcagcagccggcctacggtcagcccgcctacggccagccgcag
cccagcttcccgccgatcccgcccgcgccgaagaagtcgaaggcgctgccgatcacgctg
atctcgatcgccatcgtgctggtgctctgcgtcggcggcgtggtcgcgatcaacctgctc
gccaaggacgacaagtccaagggcaccgccacggccaccagcacctcgtccaccaaggcc
accgagggcggcgcggccaagccggccgccgacatcaccgtcgtcgagccgaagacactg
ggcggccggccgaaactcaccaccgccgagttcgccaccatcaccaagaccatgcaggag
ggtctgaaggacggctacccgggcgccaccaagtcgctcggcgcgttctacggcaccccg
gtgaagaagaacatggtgatgacgatcgcggtggccgcgccgatctccgacccggagctc
gagctcgaccgcaacttcaccagcatgagcacgaccggcttctcggccgagcacatcacc
gcggtggacaccggctcgttcggtggctcggccaagtgcggcgacggcaaggtctcctcg
gtcccggtcgccgtctgcgcctggtccgactcgggcagcgtcggcatgctcgtgtggtac
tacacgtccaagagcgccgcggagaagcagttccccgcgatccgcgccgaaatcgagaag
gtcggctag

DBGET integrated database retrieval system