KEGG   Actinoplanes sp. SE50/110: ACPL_7132Help
Entry
ACPL_7132         CDS       T02044                                 

Definition
(GenBank) heat repeat-containing PBS lyase
Organism
ase  Actinoplanes sp. SE50/110
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: HEAT_2 DUF2019
Motif
Other DBs
NCBI-ProteinID: AEV88012
UniProt: G8SGX2
Position
complement(7872861..7873481)
Genome map
AA seq 206 aa AA seqDB search
MIMGLVKKPAAAPEPPPSLGPDDLIALLDHPDPERRREAALDLAGVPEAVPGLLARAGLE
TEPRVRDAVLTTLAGHDTEAVAAGLAVHLASDDAGLRTAVAEALATMPGSVPALLPDLLA
APDHDVRVMTAMVLADLPDPEARTWLVRMITDDPHPNVVTAAIDALLPGAGPEHAAVLEA
AAQRFPDDPFLIFTVRAALPRLTGTA
NT seq 621 nt NT seq  +upstreamnt  +downstreamnt
atgatcatgggactggtcaagaagccggctgccgcgccggaaccaccaccgagcctcggc
ccggacgacctgatcgcgctcctcgatcaccccgacccggagcgccgccgggaggccgcc
ttggacctggccggggtgcccgaggcggtgcccgggctgctggcccgggccggcctggag
accgagccgcgggtccgcgacgcggtgctgaccaccctggccgggcacgacacggaggcg
gtcgcggccggtctggcggtgcacctggccagcgacgacgccggactgcggaccgcggtg
gcggaggcgctggccaccatgccgggctcggtcccggcgctgttgcccgacctgctcgcg
gcgcccgaccacgacgtgcgggtgatgaccgcgatggtgctggccgacctgcccgacccg
gaggcccgcacctggctggtccggatgatcaccgacgacccgcacccgaacgtggtcacc
gccgcgatcgacgcgctgctgcccggggccggtcccgagcacgccgcggtgctggaggcc
gccgcccagcggttcccggacgacccgttcctgatcttcacggtccgggcggcgctgccc
cggctgaccggtacggcctga

DBGET integrated database retrieval system