KEGG   Actinoplanes sp. SE50/110: ACPL_8418Help
Entry
ACPL_8418         ncRNA     T02044                                 

Definition
(GenBank) non-coding RNA with unknown function
Organism
ase  Actinoplanes sp. SE50/110
SSDB OrthologParalogGene clusterGFIT
Position
complement(7917672..7918114)
Genome map
NT seq 443 nt NT seq  +upstreamnt  +downstreamnt
atcgcaagcaacacacacaacatagatctcattacattacggcatcacttgacgggcctg
gtccgtcgaaggcgtcgcctcccgctgaccgcgcgggggtggtgagatattcagcggtcg
acctacaactccacacacactctgatcccgagtcaccatccagcgacccggacgcggagg
ccgacggcactcgccggcggggtccgacagagcttcgacgggaggaaaccgcgcgaggca
ttgtcacactccgttgacgatcgccggccgggttcggcgacggaacgaggcgtgacgggg
cggcgtggcgctcgcgagccggttggcgcagcgggcggcaggtcggacggattccgtccc
gggcaaccgggcggcaggccggacgactccgcgccgggcatgcgggcaggtcggacggct
cccgtcccggactccgggcgggc

DBGET integrated database retrieval system