KEGG   Anaerolinea thermophila: ANT_13080Help
Entry
ANT_13080         gene      T01410                                 

Gene name
tgt
Definition
(GenBank) pseudogene
Organism
atm  Anaerolinea thermophila
SSDB OrthologParalogGene clusterGFIT
Other DBs
NITE: 
Position
complement(1470580..1471113)
Genome map
NT seq 534 nt NT seq  +upstreamnt  +downstreamnt
ttgaatttccccggacatgccattggtgggctttctgtgggagaaaccaaagccgagatg
cacgccatgctggagattgtcaacggaatcttaccggcaaacaaaccccgctacttaatg
ggcgtaggctctcccgaagacctggtagaagggattgcacgtggcgtggatatcttcgat
tgcgtattacccacccggttggcgcgtcactcggcggcaatgacctttaccgggcgattg
aacctgatgaatgccgggtttgcccgagaccctcgtcccattgatgaaacctgcacttgt
tacacctgtcgtactttcagccgggcttatctcagacacctcatcgttgccagagagatg
ctggcatccaccctgatctccattcacaacattcataccctgcttaccctggtacggcga
gcgcggcaagccattctggaaaaacgcttcaacgaattccgggaggaatttctctcccat
tatcaaccccgtgggaaacatgcacacccccttgacgaaaggaaaacaccatga

DBGET integrated database retrieval system