KEGG   Anaerolinea thermophila: ANT_13550Help
Entry
ANT_13550         gene      T01410                                 

Gene name
ppk
Definition
(GenBank) pseudogene
Organism
atm  Anaerolinea thermophila
SSDB OrthologParalogGene clusterGFIT
Other DBs
NITE: 
Position
complement(1519569..1521623)
Genome map
NT seq 2055 nt NT seq  +upstreamnt  +downstreamnt
gtggataatcctgttttcgatcctcaaaatttggattcaccagatttgtatctgaaccga
gaattaagtcttcttgaatttcaattccgcgttttggatgaggctcgcgatcccaccaat
cctctgctggaaagggtgaaattccttgccattgtaggatccaacctggaagaatttttc
atggtacgggttggcggcctaaaaatgcaaaaagaaaccggggtgtttgagcttccgcct
gatggattaaccccatctcaacaattagccgagattcgtaaagtagcactgaagttgatg
gagaaagccgaaacagtctggcgcgaagagctgctcccggcattgaaggaaaacggcatt
tatgtactggattaccatgaactcaccccaaaacagcgtgaaaatgtcaacgcttatttc
cacgaaatcatttatcccgtgctaaccccgcttgcctatgaccccgggcatccatttcca
catatttccaacctgagtctgaacctggcagtcatggtgagaggaaagaataatgtcaag
cgctttgcacgaatcaaggtcccgccatctcttcctcaacttgtcccgatcaagcgctct
tctggaagcactcgcaaagatggaacgtcccccaagaaacactattttgtctggattgac
caggtcattcaggcaaatttagcccatctattcccgggcatggaggtgctggaatcgcac
accttccatgtaaccagaaactccgacatggaaattcaggaactggaagccctggacttg
ctggacttgattgaagaaagcgtgaggaaaagacgctttggggcggtaacccgtttgatg
attcaccccaacatgtcgccagaaatacggaaaattctcatcgaaaacctcaaagtcgaa
cccagtgagatttatgagttaaatgggccactggtgctcagcaatttattcgaattaacc
cggattgaccggtatgatttgaaggataaaccattcttccccgccatacccgaagcgctt
aagaaggaacctctggaagatgaaaatctcttccatgccattcggcaaaaggatatctta
ctgcaccatccctatgactcatttaatcccgtcattgactttctgagagccgcctcacgc
gaccctcatgttctggcaatcaaacaaacactttatcgggtagggaaggactcgccagtg
gtccatgccttactggaagcccagcgagactacggaaaacaagtggctgtgctggtcgag
ttgaaggcgcgttttgatgaagaaagcaatattggatgggcaaaaatcctcgagcaggaa
ggtgtccatgttatttatggattgttgggattgaaaacccattccaaagttgctctggtg
gtccggcgggaaggaaaccatattcgtcggtatatccacctgagcaccgggaactacaat
cacattactgcgaatatttatgaagatatcggaatgtttacctgtgacgaagaaatcggc
gcagatgccaccgatttattcaattacttgaccgggtatgcctccagagacacttaccgg
aaattgctggtggctcccattaaccttcgccaacggtttgaatccctgattcggcaagag
attgcccatcaaaagtcaggaaaacagggttatctgttatttaaaatgaatgccctggtg
gataagcccatgatccgcttgctgtatgaagcctctcaagccggggtaaagatagatctg
attgtagacgctgtaacaaacttggtggagaaagggaaaaaaaggaagggatcctgtaag
atattgatatcacaactccaggagcccttccatgaagattatactccaactgccacaggt
aaaacgaaaaaagcctgctcgtccgaagcgctgtccatattgtcagggggagacattcca
gcgatggggagtggagaaaaggcgcatcgaggatgtcaaagttcgtcatgtcgaggtggt
gaggtatcgatgcacacggtgcaggcgcacctttcgggactatccggagggggtaggcaa
tggacggcacagtga

DBGET integrated database retrieval system