KEGG   Bacillus anthracis A0248: BAA_2858Help
Entry
BAA_2858          gene      T00892                                 

Definition
(GenBank) pseudogene
Organism
bai  Bacillus anthracis A0248
SSDB OrthologParalogGene clusterGFIT
Position
complement(2597261..2597989)
Genome map
NT seq 729 nt NT seq  +upstreamnt  +downstreamnt
gtggaaacgagtaatagtgaaaagtatgtattttatagagagaagtattattgtttgtac
gaatatgttgctggaagtgtacttgaaataaaagatacggaaattttgaaagagctagga
agtacaattggagtagaaatagctaatctacatcaagcgcttaattcggtgaataataat
aacgagttagtaaaaagagatttatataaagtagtatacggatgggctttacctatttta
gaaaagaatgagtatgttcatcaggatgtaattcgaaaaatgaatcaaatacatatagat
ttcaaggaaacagttcactcattacgaaaacaaattattcatcgcgatatgcacttatca
aatgtaatctttaaagataatgaatttcaaggttttatagattttgaactattggaaagt
aatgtaagagtattcgatttatgctattgctgtacgagtattttgagtgagttatatagt
gatgaagtattaagagggaagtggcaacatattatcagcacaatctttgaaggatataat
aaacaaaacattttaacgagagaagaactacaatccatttggtatgttatgctttctatc
caagttatatttattacttattttgttcagttaaaagatttattaaagctaaatgaagag
atgtttttttggatttttgctaataaagaggctattgaagagtcaatagaaaggatcgca
cgaaaatga

DBGET integrated database retrieval system