KEGG   Bacillus anthracis Sterne: BAS2414Help
Entry
BAS2414           gene      T00184                                 

Definition
(RefSeq) pseudogene
Organism
bat  Bacillus anthracis Sterne
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
2413592..2415071
Genome map
NT seq 1480 nt NT seq  +upstreamnt  +downstreamnt
ttgaaactaaaagagctggcgaatttgttattggttaaagaaactattggcgatatgaat
gtaaaaattacgggattagaaatggattctagaaagataactaatggtaacctatttata
tgtgtatcaggtatcgatggttttcttgaagatcgacatcaatttgttgaagatgcagtg
aaaaatggtgctgtagcgctaattgtagaaagagatgtaaatattgagatacctaaaata
attgttaaagatgctaggtatgctatggcagttattgcgtcacatttctatggttatcca
tctaataaaatgaagttaattggaattacagggacaaatgggaaaacaactacttcctat
ttacttgaaaaaattttaagtgattatggatatcacacggggctcatggggaataacgga
gtgaaagtgggttcaaaatggtatcctactgatattaatacgcaagaacctccaacactt
caacggaatttgcaaatgatgaaaaatcaaaatgcagattattgtgttatggaagttacg
tcacaagggttacatatggaaagagttaaagggtgtaactttaaaatagctgttttcaca
aatttaacacaagatcatttagattatcatggaacatttgatgaatataagcatgtaaaa
agtcttctttttgcgagattaggaaataatttatctactatagataaaaaaatagctgtt
ttgaatgcagacgatccatcggtagaatactttaaaaaaattacttcagctgaggttatc
acatatggaatacataatggagcagatgttcaagcgaagaacataactttaagtccaaaa
ggaattcgttttttagtttcgtcctttaatggcgaaatagaggttagccttaatcttgta
ggtcgttttaatgtttataatgcattagcagcaataacagttgcattggttgaaggtatt
ccgcttacaaacattagtgatagcttatctaacttaaagagtattgaaggtagaatggaa
atcatagatgaaaatcaagatttccttgtaatagtggactatgctcatacaccggatgcg
ttagaaaatgttctctctacaattagagagtttgcaaaaggtaaaattattactgttttc
ggttgtggtggagatagagacgcaaaaaaaacgatctataatgggtggaattgctggaag
ttatagtgattttgtttttattacttctgataatccacgttcggaagatccgcaggcaat
aatgaaagatattgaaaaaggattttcgcaaaataataatttgaattataaagtggaagt
agatcgtgaacttgcaattaatcacgcaataaacatggcatcttctaatgatattgtttt
gattgcagggaaagggcatgaaacgtatcaaattttaaaagattcaactattcattttga
tgataaagaaaaagctcgacaagcaattattaataaatga

DBGET integrated database retrieval system