KEGG   Blattabacterium Bge (Blattella germanica): BLBBGE_296Help
Entry
BLBBGE_296        tRNA      T00995                                 

Gene name
trnN
Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bbl  Blattabacterium Bge (Blattella germanica)
Pathway
bbl00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bbl00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    BLBBGE_296 (trnN)
Non-coding RNAs [BR:bbl03100]
 Transfer RNA
  tRNA
   BLBBGE_296 (trnN)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
285790..285866
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
tcctcagtagctcagttggttagagcacctgactgttaatcagggtgtcgctggttcgaa
tccagcctgaggagttt

DBGET integrated database retrieval system