KEGG   Blattabacterium Bge (Blattella germanica): BLBBGE_307Help
Entry
BLBBGE_307        tRNA      T00995                                 

Gene name
trnA
Definition
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bbl  Blattabacterium Bge (Blattella germanica)
Pathway
bbl00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bbl00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    BLBBGE_307 (trnA)
Non-coding RNAs [BR:bbl03100]
 Transfer RNA
  tRNA
   BLBBGE_307 (trnA)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
294919..294995
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggggattagctcagctggctagagcgcctgctttgcacgcaggaggtcatcggttcgac
tccgatattctccattt

DBGET integrated database retrieval system