KEGG   Bacillus cereus ATCC 14579: BC0274Help
Entry
BC0274            tRNA      T00127                                 

Definition
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
bce  Bacillus cereus ATCC 14579
Pathway
bce00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bce00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    BC0274
Non-coding RNAs [BR:bce03100]
 Transfer RNA
  tRNA
   BC0274
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1202627
Position
244362..244437
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggtcccgtggtgtagtggttaacatgcctgcctgtcacgcaggagatcgccggttcgacc
ccggtcgggaccgcca

DBGET integrated database retrieval system