KEGG   Bacillus cereus ATCC 14579: BC0280Help
Entry
BC0280            tRNA      T00127                                 

Definition
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bce  Bacillus cereus ATCC 14579
Pathway
bce00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bce00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    BC0280
Non-coding RNAs [BR:bce03100]
 Transfer RNA
  tRNA
   BC0280
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1202633
Position
245032..245102
Genome map
NT seq 71 nt NT seq  +upstreamnt  +downstreamnt
gcgggtgtagtttagtggtaaaacaagagccttccaagctctggtcgagagttcgattct
cttcacccgct

DBGET integrated database retrieval system