KEGG   Bacillus cereus ATCC 14579: BC1152Help
Entry
BC1152            gene      T00127                                 

Definition
pseudogene
Organism
bce  Bacillus cereus ATCC 14579
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
JCVI-Pathema: 
Position
1131118..1132966
Genome map
NT seq 1849 nt NT seq  +upstreamnt  +downstreamnt
atgtgcgggattacaggatgggtggattataaacgctcattagaaggagaaagagatgtc
gttacgaagatggctgagacgttagcgaaacgggggccggatgataataaagtttggatt
aaaggaaatgtcgcatttgggcataagcggttaatcgttgtggatcctgagggcggtaaa
cagccgatgacttgtttaaaagatgaaacgaattacgccatttgctataacggtgaactt
tataacacagaagacattcgaaaggaattattaagaagaggatataggttcaaaggtcat
tctgatacagaagtattattagcttcttatattgaatggaaagaagaatgtgtcgatcat
ttaaacggtatatatgcgtttgcagtatgggacgaacagaaagaacaagtatttattgcg
agagatcgattaggtgtaaagccacttttttataaatatgatagcggacgcttactattt
ggttcggagttaaaagcgatattgtcgcatccagatgtgaaggcggaagtaacgttagaa
ggattatcagaaatattcgggctcggaccgtcaagaacgcctggccacggtatttatgct
ggtataaaagaattgcgtccaggtcatgcgatgacattttcaaagaacggtttgtgtata
tggagatattggaatgtagaaagtaaaaaacatgaagactcttttgaagaaacagtagag
aaaacgcgctttttattacaagatgctattacaagacagcttgtttctgatgtaccacta
tgtacttttttatcgggtggtgtagattcgagcgctattacagctattgcagcgaaagaa
tatgagagatcgggaaaagggcaattacacacgtattctattgattacgaagataatgac
aaatactttaaagcgaatgcattccagccaaattcagatgctccgtttattaatttaatg
actgagacatttcaaaccaacccatcatcgctgcgtcatttcgaatgaaaaattagcaga
gtatttaactgaagcagtactcgttcgtgatttgcctggtatggcagatatcgattcgtc
attattatggttttgccgagaaattaaacaagattttgtcgttggcttatctggagaatg
tgcagatgaaatatttggtggatatccgtggttttatagagaagatgatttacaatcgag
tgcatttccgtggatgcgttctacagaggcacgtgaacaacttctaaaaaaagaatggag
aaataaattaaatttacaacaatatgtacaaaggcgctatgaagagtcgattcaagaagt
tcctattttagagggggaaagtccgctagaagcaaaaagacgccaattattttatttaaa
tatgatatggtttatgacaacattattagacagaaaagaccgcatgagtatgggggcgag
cttagaagtacgtgttccatttgcagatcatcgtcttgtcgaatatgcgtggaatattcc
ttgggaaatgaaaatgtataaaaaccgcgaaaaaggtctattacgtaaagcgttagaagg
tatacttccacatgacatcttatatagaaagaagagtccttatccgaaaacgcacaatcc
gcactatacaaaagcagtaacagtatggcttcaaaatctattaacggataaaggttcaat
tttacacgaactgtttgataaagagcagttgagcggattaattcagtctggcggcagtgc
atttcaaacaccatggtttggtcaattgatgactgggccacagcttttagctcatttagc
acaaattcacgtttggtttaaagaatatggggtaaatattaaagaatag

DBGET integrated database retrieval system