KEGG   Burkholderia cenocepacia HI2424: Bcen2424_6607Help
Entry
Bcen2424_6607     gene      T00415                                 

Definition
(GenBank) pseudogene
Organism
bch  Burkholderia cenocepacia HI2424
SSDB OrthologParalogGene clusterGFIT
Position
3:836234..836558
Genome map
NT seq 325 nt NT seq  +upstreamnt  +downstreamnt
atgcgcgagctggaccgattcaaggccattcaggacgtggccgacggcaagctcaagccg
cggcgtgcagcgacggttggagttgacgacacggcagattgagcgtctggtattgcgccg
ctatcgtgctgccggcgtggcggggttggtgtcaggcaagcgcgggcgcatcaactgcct
gctggaaaggcgcagcgggcgctggcattgctacgcggatttcgaggatcgtgcgccggc
ctgcacattactggtgttcatcgacgatgcaaccggacggctcatggcgctgcacttcac
ggcgaacgagtcgaccttcagctat

DBGET integrated database retrieval system