KEGG   Burkholderia cenocepacia J2315: BCAM1918Help
Entry
BCAM1918          CDS       T00771                                 

Definition
putative phage lysozyme
Orthology
K01185  
lysozyme [EC:3.2.1.17]
Organism
bcj  Burkholderia cenocepacia J2315
Brite
Enzymes [BR:bcj01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.17  lysozyme
     BCAM1918
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
2:2131628..2132182
Genome map
AA seq 184 aa AA seqDB search
MAFQLSRKWLVGAASAAVVAAAPFVTGWEGWRNTVYKDQGGVSTVCAGHTDRIGTENITK
QTYTNEECGRILIKDLNKDEAQLRASIGYDVPLTQGQEVILIDFVHNLGIGALNAGSLRP
LLLRGDVNKACAKILEYKYARVGPGGSLQEVKGLRLRREAENRVCTGQTTVDQEAALRGV
ILVN
NT seq 555 nt NT seq  +upstreamnt  +downstreamnt
atggcatttcagttatcaagaaaatggttggtaggtgcggcgagcgcagcagtggttgcg
gcagcgccctttgtcacggggtgggaaggctggcgcaacacggtctacaaggatcagggc
ggcgtttctaccgtgtgcgcgggacataccgacaggatcggcaccgagaatatcaccaag
cagacctacaccaacgaggaatgcggccggattctcatcaaggatttgaacaaggacgag
gcgcagctacgagcctcgattggctacgacgtgccgcttacgcaggggcaggaagtcatc
ttgatcgacttcgtgcacaacctcggaattggcgcgttgaatgccggatcgttgcgcccc
cttctcttgcgtggcgacgtgaacaaggcatgtgcgaagattcttgagtacaagtacgcg
cgcgtgggtccgggcggttcgttgcaggaagtgaagggattgcggttgcgccgtgaagct
gagaaccgcgtgtgcacaggtcagacgacggtagatcaagaagccgcgctacgcggtgtc
attttagttaattaa

DBGET integrated database retrieval system