KEGG   Bacillus cellulosilyticus: Bcell_0205Help
Entry
Bcell_0205        gene      T01389                                 

Definition
(GenBank) pseudogene
Organism
bco  Bacillus cellulosilyticus
SSDB OrthologParalogGene clusterGFIT
Position
223817..224014
Genome map
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
aaaggaataggtttaactcctcaattagccgttgtgaattaatttgtttatgttcggggg
cattagagaagcctgtacaagaaagtactgttgttttaggaaataacagtagggggaagg
attgagaaggttggagaactggcaaacgttatacaggtttgcgttgatgcagtggtcaag
gctttaggggttagttaa

DBGET integrated database retrieval system