KEGG   Bacillus cellulosilyticus: Bcell_0232Help
Entry
Bcell_0232        gene      T01389                                 

Definition
(GenBank) pseudogene
Organism
bco  Bacillus cellulosilyticus
SSDB OrthologParalogGene clusterGFIT
Position
252941..253273
Genome map
NT seq 333 nt NT seq  +upstreamnt  +downstreamnt
atagcagcaacatgtgctttaatcgttttaatctcaattccaattgtcatatgggggctg
gaagtatatgaagaactaaatgaagaaacaatcttgctaataagtgagtcacctaatgcc
accaataccattgaagttgttgaaaaagggtatgttgggggtgaaacggattctaaagtc
attattaaatctcagggtaactccattgaacaaagggttttacaggacaggtacagactt
gaatcatccaatgtaatagtggaatggattaatgaacaggaatcatatgttactctttct
ggaaagaaacaagagccggagataatagagttt

DBGET integrated database retrieval system