KEGG   Bacillus cellulosilyticus: Bcell_R0025Help
Entry
Bcell_R0025       tRNA      T01389                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  
tRNA Asn
Organism
bco  Bacillus cellulosilyticus
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bco00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bcell_R0025
Non-coding RNAs [BR:bco03100]
 Transfer RNA
  tRNA
   Bcell_R0025
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
183737..183812
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tccacagtagctcagttggtagagcaatcggctgttaaccgatcggtcgtaggttcgagt
cctacctgtggagcca

DBGET integrated database retrieval system