KEGG   Bacillus cellulosilyticus: Bcell_R0026Help
Entry
Bcell_R0026       tRNA      T01389                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  
tRNA Asn
Organism
bco  Bacillus cellulosilyticus
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bco00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bcell_R0026
Non-coding RNAs [BR:bco03100]
 Transfer RNA
  tRNA
   Bcell_R0026
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
183899..183974
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tccacagtagctcagttggtagagcaatcggctgttaaccgatcggtcgtaggttcgagt
cctacctgtggagcca

DBGET integrated database retrieval system