KEGG   Bacillus cellulosilyticus: Bcell_R0032Help
Entry
Bcell_R0032       tRNA      T01389                                 

Definition
(GenBank) tRNA-Ala
  KO
K14218  
tRNA Ala
Organism
bco  Bacillus cellulosilyticus
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bco00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Bcell_R0032
Non-coding RNAs [BR:bco03100]
 Transfer RNA
  tRNA
   Bcell_R0032
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
185473..185548
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgccttgcacgcaggaggtcagcggttcgatc
ccgctaggctccacca

DBGET integrated database retrieval system