KEGG   Burkholderia glumae BGR1: bglu_1gt01Help
Entry
bglu_1gt01        tRNA      T00905                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  
tRNA Arg
Organism
bgl  Burkholderia glumae BGR1
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bgl00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    bglu_1gt01
Non-coding RNAs [BR:bgl03100]
 Transfer RNA
  tRNA
   bglu_1gt01
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1:123102..123177
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gcgcccgtagctcaatggatagagtactgccctccgaaggcaggggttgctggttcgatc
ccagccgggcgcgcca

DBGET integrated database retrieval system