KEGG   Bifidobacterium longum subsp. infantis ATCC 15697 (JGI): Blon_R0038Help
Entry
Blon_R0038        tRNA      T00794                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  
tRNA Val
Organism
bln  Bifidobacterium longum subsp. infantis ATCC 15697 (JGI)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bln00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Blon_R0038
Non-coding RNAs [BR:bln03100]
 Transfer RNA
  tRNA
   Blon_R0038
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
1334510..1334582
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gggcgattggcgcagcggctagcgcacttcgttcacaccgaaggggtcgtaggttcgatt
cctacatcgccca

DBGET integrated database retrieval system