KEGG   Bifidobacterium animalis subsp. lactis V9: BalV_0478Help
Entry
BalV_0478         CDS       T01843                                 

Definition
Dihydroneopterin aldolase
Orthology
K13940  
dihydroneopterin aldolase / 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase [EC:4.1.2.25 2.7.6.3]
Organism
blv  Bifidobacterium animalis subsp. lactis V9
Pathway
Folate biosynthesis
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:blv00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00790 Folate biosynthesis
    BalV_0478
Enzymes [BR:blv01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.6  Diphosphotransferases
    2.7.6.3  2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
     BalV_0478
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.2  Aldehyde-lyases
    4.1.2.25  dihydroneopterin aldolase
     BalV_0478
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
594173..595042
Genome map
AA seq 289 aa AA seqDB search
MTTVDCSGIDLGSNEDDMRVWTADVSWVIDDDQLVDAEDLAAHVAAIGQMMLGVPVEQLA
ERIAAQLANQSVFRSVTVTVHMHWKAPLRTFEQLSATVTANRQSSANPSAAAANTGGEES
ASTHDGALPVDPSYRDAVISLHSAALNAEQLFREVIVTLDSMPGNQVDGISPLYFVGSLN
GTDGHAAVIKLSTAMGVRQLNQVLDALHTTHEGAVQLSVVATGKVGDESLHAPKGAADHH
LGAAVLEPWAAMDPNASYNGDPLAYLLAMAPDSAQVGVESERWVMGGGR
NT seq 870 nt NT seq  +upstreamnt  +downstreamnt
atgacaaccgtggactgcagcggcatcgacctgggcagcaacgaggacgacatgcgtgtg
tggacggcggacgtcagttgggtcatcgacgacgaccagctggtggatgccgaggatctg
gccgcacatgtggcggccatcgggcagatgatgctcggcgtgcccgtcgaacagcttgcc
gagcgcatcgcggcgcagctggcgaaccaatcggtgttccgctccgtcactgtcaccgtg
cacatgcattggaaggccccattgcgcaccttcgaacagctcagtgcaacggtcaccgca
aaccggcaatcctcggccaacccatctgctgccgctgcgaataccgggggcgaggaatct
gcaagcacgcatgatggggcattgccggtcgacccgtcataccgcgatgccgtcatttct
ttgcatagtgccgcgctgaatgccgagcagctgttccgtgaggtcatcgtcacactcgac
agtatgccgggcaaccaagtggacggcatctccccactgtatttcgtgggctccctcaac
gggaccgacggccatgccgccgtgattaaactcagcaccgcaatgggagtgcgtcagctg
aatcaggtgctcgatgcgctgcacaccacacacgagggagccgtgcagctgtcggttgtg
gccacaggcaaagtgggggatgaatcactgcatgcaccgaaaggtgcggcggatcatcat
ctcggcgctgccgtgcttgagccatgggctgccatggatcccaatgccagctataacgga
gacccactggcgtatctgctggcaatggcgcccgacagcgcacaggtgggcgtcgaatcc
gaacggtgggtcatgggaggcggccgatga

DBGET integrated database retrieval system