KEGG   Brucella melitensis bv. 1 16M: BMEII0974Help
Entry
BMEII0974         CDS       T00072                                 

Definition
(RefSeq) nitrous-oxide reductase (EC:1.7.99.6)
Organism
bme  Brucella melitensis bv. 1 16M
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(1011667..1012425)
Genome map
AA seq 252 aa AA seqDB search
MTEETRKSQLSRRQLLGTSAFVAAAGASGLGGALLAGSSETALAAGAAKGGMSPEVKPGE
LDEYYVFFSSGQCGEVRIVGLPSMRELMRIPVFNRDSATGWGLTNESRKVLTEGLLPQDR
EFLKDRGDIFLNGDLHHPHPSFTDGTYDGRYLYANDKANTRVCRIRLDVMKCDKIIQLPN
QHTVHGLRVQKYPKTGYVFCNGEDRVPIPNDGSHLNDVKQYHAIFTAVDGETMKVAWQVM
VDGNLDNVDCDY
NT seq 759 nt NT seq  +upstreamnt  +downstreamnt
atgactgaagaaaccaggaaatcgcagctcagtcgaagacaattgctcggaacttcggca
tttgtcgcggcagccggtgcaagcgggctcggcggggctctgcttgccggttccagcgaa
actgcgcttgcggctggcgccgcaaagggcggcatgagccccgaagtcaagccgggggaa
ctggacgaatattacgtcttcttctccagcggccagtgtggtgaagtgcgtattgtcggc
ctgccgtcgatgcgtgagctgatgcgcatcccggtcttcaaccgtgacagcgccaccggt
tggggcctgacgaatgaaagccgcaaagtgttgacggaaggcctgcttccgcaggaccgt
gaattcctcaaggatcgcggcgacatcttcctcaatggcgacctgcaccacccgcatccc
tctttcaccgatggaacctatgacggtcgttatctttatgccaacgacaaggccaatacg
cgcgtctgccgtatccgcctcgacgtgatgaagtgcgacaagatcattcagttgccgaac
cagcatacggttcacggcctgcgtgtgcagaaatatccgaagaccggctatgtcttctgt
aatggcgaagaccgtgtaccgatcccgaatgatggcagccacctgaatgacgtcaagcag
taccatgccatcttcaccgccgttgacggtgaaacgatgaaggtcgcctggcaggtgatg
gtcgatggcaatctcgacaatgtggattgcgactattag

DBGET integrated database retrieval system