KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03209Help
Entry
BMULJ_03209       CDS       T00740                                 

Gene name
bdh
Definition
(GenBank) 3-hydroxybutyrate dehydrogenase
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
2:complement(13665..14450)
Genome map
AA seq 261 aa AA seqDB search
MSNLNGKTAVVTGAASGIGKEIALELAKAGAAVAIADLNLDGANAVADEINKAGGKAIGV
AMDVTNEEAVNTGIDKVAETFGSVDILVSNAGIQIVNPIENYSFADWKKMQAIHVDGAFL
TTKAALKHMYKDDRGGVVIYMGSVHSHEASPLKSAYVTAKHGLLGLARVLAKEGAKHNVR
SHVVCPGFVRTPLVDKQIPEQAKELGISEEEVVKKVMLGNTVDGVFTTVQDVAQTVLFLS
AFPSAALTGQSFVVSHGWFMQ
NT seq 786 nt NT seq  +upstreamnt  +downstreamnt
atgagcaacctgaatggcaagaccgcagtcgtcacgggcgccgcgagcggcatcggcaag
gaaatcgcgctggagctggcgaaggcgggtgcggccgtcgcgatcgccgatctgaacctg
gacggcgcgaacgcggtcgccgacgagatcaacaaggccggcggcaaggcgatcggcgtc
gcgatggacgtgaccaacgaggaagccgtcaacaccggcatcgacaaggtcgccgagacg
ttcggctcggtcgacattctcgtgtcgaatgccggcatccagatcgtcaacccgatcgag
aactactcgttcgccgactggaagaagatgcaggcgatccacgtcgacggcgcgttcctc
acgacgaaggccgcgctcaagcacatgtacaaggacgatcgcggcggtgtcgtgatctac
atgggctcggtgcactcgcacgaggcgtcgccgctgaagtcggcctacgtgacggccaag
cacggcctgctcggtctcgcgcgcgtgcttgcgaaggaaggcgcgaaacacaacgtgcgc
tcgcatgtcgtgtgtccgggtttcgtgcgcacgccgctcgtcgacaagcagattccggag
caggccaaggagctcggcatcagcgaagaggaagtcgtgaagaaggtgatgctcggcaat
acggtcgacggcgtgttcacgaccgtgcaggacgtcgcgcagacggtgctgttcctgtcg
gcgttcccgagcgccgcgctgaccggtcagtcgttcgtcgtcagccacggctggttcatg
caatga

DBGET integrated database retrieval system