KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03230Help
Entry
BMULJ_03230       gene      T00740                                 

Gene name
folE
Definition
(GenBank) folE
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(31793..32422)
Genome map
NT seq 630 nt NT seq  +upstreamnt  +downstreamnt
atgggaaaaaaaaccgcgcggtccgagccggccgcatcccgcccgagtcgtgaagaagcc
gaggacgccgtacgcgtcctgctgcgctgggccggcgacgatccgacgcgcgaagggctg
atcgatacgcccgcgcgcgtcgtgcgcgcctacgagcagttcttcgccggctattcgatc
gagccgcgcgacatcctcgcgcgcacgttcagcgaagtcgacggctacgacgaaatgatc
gtgctgaaggacatccgcttcgagagctactgcgagcatcacatggtgccgatcatcggc
cgcgcgcacgtcgcgtatctgccgaatcatcgtgtggtcggcatctcgaagctcgcgcgc
ctcgtcgatgcgttcgcgaagcgcctgcagatccaggaaaagatgacggtgcagatcgcc
gacacgctgttcgatgtgctgcagccgaaaggcgtcggcgtgatactcgaagccgcgcat
cagtgcatttcgacgcgcggcgtgcacaagccgggcgtcgagatggtcacgtcgcggatg
ctcggcacgttccgcaccgatccgtcgacgcggcgcgaattcctgtcgatcgtcgcgaac
ccgtcttccgtgaacctgacgaatacgtaa

DBGET integrated database retrieval system