KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03230Help
Entry
BMULJ_03230       CDS       T00740                                 

Gene name
folE
Definition
(GenBank) GTP cyclohydrolase I
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
2:complement(31793..32422)
Genome map
AA seq 209 aa AA seqDB search
MGKKTARSEPAASRPSREEAEDAVRVLLRWAGDDPTREGLIDTPARVVRAYEQFFAGYSI
EPRDILARTFSEVDGYDEMIVLKDIRFESYCEHHMVPIIGRAHVAYLPNHRVVGISKLAR
LVDAFAKRLQIQEKMTVQIADTLFDVLQPKGVGVILEAAHQCISTRGVHKPGVEMVTSRM
LGTFRTDPSTRREFLSIVANPSSVNLTNT
NT seq 630 nt NT seq  +upstreamnt  +downstreamnt
atgggaaaaaaaaccgcgcggtccgagccggccgcatcccgcccgagtcgtgaagaagcc
gaggacgccgtacgcgtcctgctgcgctgggccggcgacgatccgacgcgcgaagggctg
atcgatacgcccgcgcgcgtcgtgcgcgcctacgagcagttcttcgccggctattcgatc
gagccgcgcgacatcctcgcgcgcacgttcagcgaagtcgacggctacgacgaaatgatc
gtgctgaaggacatccgcttcgagagctactgcgagcatcacatggtgccgatcatcggc
cgcgcgcacgtcgcgtatctgccgaatcatcgtgtggtcggcatctcgaagctcgcgcgc
ctcgtcgatgcgttcgcgaagcgcctgcagatccaggaaaagatgacggtgcagatcgcc
gacacgctgttcgatgtgctgcagccgaaaggcgtcggcgtgatactcgaagccgcgcat
cagtgcatttcgacgcgcggcgtgcacaagccgggcgtcgagatggtcacgtcgcggatg
ctcggcacgttccgcaccgatccgtcgacgcggcgcgaattcctgtcgatcgtcgcgaac
ccgtcttccgtgaacctgacgaatacgtaa

DBGET integrated database retrieval system