KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03339Help
Entry
BMULJ_03339       gene      T00740                                 

Gene name
adh
Definition
(GenBank) adh
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:146966..148012
Genome map
NT seq 1047 nt NT seq  +upstreamnt  +downstreamnt
atggcgaactcagcgacctaccgcgcggcggtagtgaaggcaccggggcaactggaactg
gtcgagcgcccgatgcctgacccggcgcccggacaggtgcgcatccgcgtggaagcgtgc
ggcgtgtgccactccgacagcgcaaccgtggagcgcgaggcgccggtcggcgcgccgccg
cgcgtaccgggacatgaagtggtcgggcgcatcgatgcgctgggcgacggcgtcgcgggc
tggcgcgtcggcgagcgcgtcggcgtcggcttcctcgcgggcgaggaccgcacgtgtccg
tcgtgccggcacggcgatgtcgtcaactgcgagaacccgatcatcacgggcatgacgacc
gacggcggctacgcggaaatcatgctggcgcaagcgcgcgggctcgtacgcgtgccggaa
gacctcgatgcggccgaagcggcaccgctgctctgcgcagggctcacgacgttcaacgca
ttgcgcaatgccggcgcgcgggcgggcgacgtggtcgcaattcatggcctgggcggtctc
ggccatcttgccgtgcagttcgcgaggaagatgggtttctacaccgtcgcgatcgcgcgc
ggcgccgacaaggccgcgctggccgcgcagcttggcgcacaccgttatatcaatgccgcc
gccgacgacgtcgccgcgacgttgcgcacgttgggcggcgcgaaggtcgtgctcggcacg
gcgccgaccggtaccggcatggccgagaccgttgcggggcttgcggcgcgcggcaagctg
atcgtcgtggcggtgcccggcgagccgatcgcggtcaacgcggtcgatctcgtgttcggc
ggccgctcgatcgtcggtgcgctgaccggcacggtggcggacaacgaagagacgctggcg
ttcgcgcggctgcagaacgtgcggccgatgatcgagaccttcccgctcgagcacgcgcag
gcggcatacgaccggatgatgcgcgcggacgtccggttccgcgcggtactcaccatgcat
tccgcaccgacaggagtttccgcatga

DBGET integrated database retrieval system