KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03733Help
Entry
BMULJ_03733       gene      T00740                                 

Gene name
ssuB
Definition
(GenBank) ssuB
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(566563..567345)
Genome map
NT seq 783 nt NT seq  +upstreamnt  +downstreamnt
atgagcaacatcatcattaacggtctcacgaagtcattcgatacgcccaccgggcccatc
accgttctggacaacatcgacctcacagtccaggaaggcgaattcgtttgcctccttggt
ccgtcgggcgcaggcaagtccgtcacgttgaactgtatttccggattcctcccccccact
tcggggagtgtcatggtggacggcacgccggttacaactgcaaggccgcgttatgggtat
gtgttccagcaaccaaggttgctccagtggcgcaccgtcgaagagaatcttatattcgcc
ctgcgcgccgaaagcggccgtccggtaaaggatgaagcacggagggttcgggacgtcctt
gatctggtgaacctgaccggttatgagcacttctacccgcatcagatctccggcggcatg
cagcatcgcgtcggtatcgcccgcgcctatatccgcgactccgggctcctgctcatggac
gaaccgtttggggcactcgacgaaatcaccgcccgcaaactgcgggctgaactggtcagc
acgtggatgaagaaccggcgcactgttgtcttcgtcactcacgacatcatcgaagcgtgc
tatctcgccgaccggatcgtcgtctacacgcccaagccgaccaggatcgcctccgtcatc
aatgttgatctgcctcggccgcgggaatacggaagccagcagatgcacgcgctcgaatca
gaggtactcggtgtgtttgagcaaagcatgaaggaattcatggagacggccggcagtacc
tga

DBGET integrated database retrieval system