KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03820Help
Entry
BMULJ_03820       gene      T00740                                 

Definition
(GenBank) BMULJ_03820
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(664802..668458)
Genome map
NT seq 3657 nt NT seq  +upstreamnt  +downstreamnt
gtggggtcgattttgtcggagcagttgaagctcgtcgtgctgggaggatcggctggcagc
ctcgacccgttgcgcgcgatcgtcgccgcgctgccgagcgatcccggcttcgccgtgctc
gtcatcacgcacctggatccgaaggaggaaagccggctgcccgacatcctgcaagcggat
gcgcgcatgccggtcgaaaaactcgtccatctgcgcaagatcgaacacgaccgcatctat
gtgctgcctgaaaacgcgggcgtgattgcactggacggccatttccgattgacgcgcaga
caggccggcctcaacttgccgatcgacgggtgcctggcgtcgctcgcgcaggatccggac
gtcaacggcgcggcagtgatcctgtcgggcaccggccgggacggtgcaggcgggctggtg
gacctgaaggcttccggcggcttcgtcatcgcacagcagccgcagacggctattcatcat
ggtatgccgaccgcggcgatcgacacgggtctggtcgacgaagtgctgtcgctcgaggac
atcgccccgtgcctggtgcggcgcttcggcgatcctgcccgcagcgccgaagcagccgat
gcgcagacggccgacgacgacgcgctcggcacggccatctcgattgttcagcagaaaacc
ggcatcaacctcgcctacgtcaaggatgtcaatctacgccgccgattcctgcgccgcgtg
ctgctgcagaaggatcgggacgtggatgcgtacctgcagctgctgcgcagcgatgcgcgc
gaagccgaggcgctgcgcgacgacatcctgatcggcgtgacggccttctttcgcgacgcc
gagttcgtcaacgtgctgcgccaatcggtcattccggcgctgctggaactgaagcacgac
ccgatccgcgtctgggtgcccgcctgctcgacaggcgaggaggtctacaccatcgcgacg
ctgctgaaggaggcactcgatcgcgacgcgctgcatcgccgcgtgcagatcttcggcacc
gacatcaacgaggcatcgatcgaaattgcgcgggccggccgctacagcctggcgtcggtc
gacgacgtgccggaggcgtttcgcgaaagaacgttcgccgccacgtcgggcggctatgtg
gtgcgcaaggcgattcgcgaaatgtgcgtgttcgcgcggcacaacgtgctgacccacgcg
cccttctcgggcatggacctcatcagctgccgcaacctgctgatctacctgcgcaaggag
gcacaacagcacgtgctcgaggtgttgcactacgcatgccggcccgacggatttctgctg
ctcggccgcgccgaggccgtatcgggcgccgacggattcgagcacgccggcgcgccgcac
ctgtaccgcaaggtgccggcggccaagcggcagcaaggcgcgttcccgatcgacgcactg
cgtccatgggcgagccagggcaccgcgccgccggcacgccgcgcgcaacaggccgatccc
gttctggaggcggccaatcgcacggcgctcgagcgctatgcaccgccgggtttcgtcgtc
gacgacaagggcgacgtcgtgcactttcgcggcgacgtgtcgggcttcgttgcgccggcg
agcggcgaggcgtcgctggctctgccgcgcctgctgcagcccgagctcaatgtcacggtg
cgcaccgcgctgatcgaggccaagcggacaggccaacccgtgcggcgcgagcgcgtcgcg
ctcggcgacacgcatttcgcgctggaagtcctgccgctcgccgccgaggacctggtgccg
cactatctggtcacgctcgaacgattgcccgacgacgcgcccgcgccgcagaacacgaat
acgggctcgccgcacagccgcgttcaggaactcgaacgcacggtcacgacgctgtccgac
gaactcgaggccacgcaagcgcagctcaagtccgtcgtcgccgaattcgaatcggccaac
gaggaactgcgcacggccaacgaggagatgctcagcaccaacgaagagctgcaaagcgcg
aacgaggaactgctgctggccaagcaggaactggaatcggccaaccaggagcttgcgtcg
ctgaacgacgagctgaaatcgcgcaacgagcaactcgaccgcgtcaacgacgacttgagc
aatctggtcgaaggcatcccgctaccggtcgtcgtgctggaccggcagctgcgcctgcgg
catttttcgccgcaggcgcaagcgctgttcgggttgccggacgacagtgtcggacaaccg
ctcgcgcagttgaacagcctgttctcggcggtcgacctcgaacgcgtcgtgcagtcggcc
gtgcagggattggcggatgtcgagcacgagtatcaggacagcgaaggccgatggtggctc
gtcaacgtgcgtgcctatcgcacggccgacgaccgcatcgacggcgccgtactcgccttc
caggacatccatcagctcaaaagcgccctcggtaccgcacagtccgcgcaactcgatgcg
gaacgcgccaataccgcgaaggacaacttcctcgcgctcgtatcgcacgaactgcgcgcg
ccgctgaacgtgatctcgagctgggcggccgtgctcatgacggcaagcgagcgcggcatg
ccgaccgacgagcaaatgagtcagcgcgcggtcacgaccattctgcggcattgtcagctg
caggccgaactgatcgacgatttgctggacgtctcgcgcatctcgtcgggacggttctcg
ctcgattcgaagccggtcgactttgctgcggccgtacgcaccgtggtggagagccatcgc
ccggtggcggccaagaaggagatcatgctcgcgacgtcgggattgcaaagccaggcggtc
gtcagcggcgacgcgcgccgtctgcagcaggtcgcatcgaatctgatcggcaatgcgttg
aagttcacgccgcagggcggccgtgtcgaagtcgcattgacgcgtctcggtgcgctgatc
gagctctcggtcgccgacaacggcatcggcgtcaagccggaattgctgccgcggctgttc
gaccgtttcatgcagtccgacaccagtcgcacgcgccagtatggcggcctcggcctgggc
ctgtcgatcgtcaagcatctggtgacggcgcacggcggcacggtgaccgccagcagcgag
ggtgaaggtcgcggcaccaggctgacggttcgcataccgttgctgcagacggccgcgacg
gaaccgggaaccgtcgccaccgcgccggcggaatcggcacggctcgacggcctgtcggtg
ctgctcgtcgacgacgacgtgccggcccaggagccgttggcgcacttgctgcgcgggctc
ggcgcgcaagtgcagatcgcttccggtgcgaaagaagcgctcgcctgtctcgctgccggc
tctttcgatattctcgtcagcgatctcgccatgcccggcgccgacggccatgcgctgctg
cgcgacgtgcgcagtcgcgaaggcggccgacggcgcatctacgcgctggccctgacgggc
ctcgcgtcgatacacgatcgggacgccgcgattgccgccggcttcgacgaccatttgccg
aagccggtggatgtgaaggtgctgctggaaaagctgtctctggggcggggcagatag

DBGET integrated database retrieval system