KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03889Help
Entry
BMULJ_03889       gene      T00740                                 

Gene name
trpB
Definition
(GenBank) trpB
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:747554..748747
Genome map
NT seq 1194 nt NT seq  +upstreamnt  +downstreamnt
atgtacaaccttcctgacgatcgcggccacttcggcccgtatggcggcgtgttcgtcgcc
gagacgctgattcacgcgctggacgagctgcgcggcgcgtacgcgaaataccagaacgac
cccgatttcgtcgccgaattccagcgcgaactgaagcacttcgtcggccgtccgtcgccg
atctatcacgcgcagcgctggagcgacacgctcggcggcgcgcagatctatctgaagcgc
gaagatttgaaccacacgggcgcgcacaagatcaacaacgtgatcggccaggcgctgctt
gcgaagcgcatgggcaagaagcgcgtaatcgccgagacgggcgccggccagcacggcgtc
gccaccgcgacgatctgcgcgcgcttcgggatggagtgcgtcgtctacatgggcgccgag
gacgtgcgccgccaggccgccaacgtgtaccggatgaagctgctcggcgcgaccgtcgtg
ccggtcgaatcgggttcgcgcacgctgaaggacgcgctgaacgaggcgatgcgcgactgg
gtcacgaacatcgagaacacgttctacatcatcggcacggtcgcgggcccgcatccgtac
ccgatgatggtgcgcgacttccagcgcgtgatcggcgacgaatgcaaggtgcagatgccc
gaactcgccgggcgccagcccgacgcggtgatcgcctgcgtcggcggcggctcgaacgcg
atggggatcttctatccgtacatcgacgacgcgtcggtgcagctgatcggcgtcgaagcc
gcgggcgacggcctcgacaccggccatcacgcagcctcgctgatcgccggcagcccgggc
gtgctgcacggcaaccgcacctatctgctgcaggacgacaacggccagatcatcgagacg
cattcggtgtcggccggcctcgactatccgggcgtcggtcccgagcacgcatggctgaag
gacagcggtcgcgcgcagtacgtcgggatcaccgacgaagaggcgctgaaggcgttccac
gactgctgccggatcgagggcatcatccccgcgctcgagtcgagccacgcgatcgcgtat
ggcgtgaagctcgcgccgacgttgccgaaggacaagatcctgctcgtcaatctgtcgggc
cgcggcgacaaggacatgcatacggtcgccgagcgatcgggcatcacgctctga

DBGET integrated database retrieval system