KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03906Help
Entry
BMULJ_03906       gene      T00740                                 

Gene name
galU
Definition
(GenBank) galU
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:769093..769980
Genome map
NT seq 888 nt NT seq  +upstreamnt  +downstreamnt
atgttgaaagtcaacaaggccgtgtttcccgtcgccggtctcggcacgcggttccttccg
gcaacgaaggcgagcccgaaagagatgctgcccgtcgtcgacaagccgctgatccagtat
gcggtcgaggaggcgatcaacgccggcattaccgagatgatcttcgtgacgggccgcagc
aagcgcgcgatcgaggatcatttcgacaagtcgtacgagatcgaagccgagctcgaggcg
cgcggcaaggaaaagctgctggagctcgtgcgcagcatcaagccgagccatgtcgactgc
ttctacgtgcgccagccggaagcgctcggcctcgggcatgccgtgctgtgcgccgagaag
ctcgtgcacggcgagccgttcgcggtgattctcgcagacgatctgctgcacggcgagcag
cccgtgctcaagcagctcgtcgacgtgttcgatcactatcacagctcggtaatcggcgta
gagacgatcgcacgcgaggacagccgctcgtacggcgtgatcgaaggccgcgagtgggaa
gaggacgtgatcaagctgtccggcatcatcgagaagccggcacccgaagacgcgccgtcg
aacctcggcgtggtcggccgctacgtgttcatgccgacgatcttcgatcatctgcggcgg
ctgaagccgggcgcgggcggcgaactgcagctcaccgacgccgtccagtcgctgctcgcg
aacgagcaggtgctcgcgtatcgctactacggcacgcgtttcgactgcggcagcaagctc
ggctatctgaaggcgaccgtcgagctcgcgcttcagcatccggaggtcagccgcgaattc
gaagcgtatctgcgtacctgtctgcccgcgctggctgccgtcgcataa

DBGET integrated database retrieval system