KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_03937Help
Entry
BMULJ_03937       gene      T00740                                 

Gene name
adh
Definition
(GenBank) adh
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:807424..808581
Genome map
NT seq 1158 nt NT seq  +upstreamnt  +downstreamnt
atgaacccgtttcaattccgcaccgtcccgacgctgatcgtcgaatacggcgccgcgcgc
cggctcggcgcgctgctgcgcgcgcgctttccgacgctcgcgcgcctgtgcgtggtgacc
gacgcgttcctgcaccgcagcggcgtgctcgcgcccgcgctcgacagcctcgccgcgcac
ggctggcaggtgaccgtgatcgacgacgtgatcgccgatccgcccgagcgcgtcgtgctc
gacgcgacggcgcgcgcggtcgcggccgatgcgcaaatcgtgctgggtctcggcggcggt
tcgtcgatggacgtcgcgaagctgatcgccgtgctcgcgccgggccggcagccgctcgcc
gacatgtacggcgtcgacaaggtcgacaccgagcggttgccgctcgtacagatgccgacg
acggcaggcaccggttcggaggtgacggccgtgtcgatcgtcacggtgggcgaggcgcgc
aagatgggcgtcgtgtcgccgcatctgttcgccgacgtcgcgattctcgacgccgagctg
acgctcgggctgccgcgcgcggcgacggccgcgaccggcatcgacgcgatggtgcatgcg
atcgaggcctacacgtccgcgcggctgaagaatccggtgtccgacatgctggccgtgcag
gcgctgacgctgctgtcgcgcaacctgctcgccgcatgcgacgacggccacgaccggcac
gcgcgggaagcgatgctggtcggcgcgatgttcgcaggtcaggcgttcgcgaacgcgccg
gtcgcggccgtgcatgcgctcgcgtatccggtcggcggtattttccacgtgccgcacggg
ctgtcgaacgcgctcgtgctgccgcatgtgctgcgcttcaacgcggaagcggccgcgtcg
cagtatgcggaactcgcggcgatcgtcacgccgtcggcgacgggtagcgacgaggcgaag
acgcacgcactgatcgacgagatcgaccggctgatcgtcgcgaccggcattccgcgtacg
ctgcgcgaggtcggcatcggcgaaggcgatctgccgcggatggccgcggacgcgatgctg
cagacgcgcctgctcgtcaacaatccgcgcgaagtgacggaggccgacgcgctcgagatc
tatcggcgcgcgtggtga

DBGET integrated database retrieval system