KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04039Help
Entry
BMULJ_04039       gene      T00740                                 

Definition
(GenBank) BMULJ_04039
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(927101..928789)
Genome map
NT seq 1689 nt NT seq  +upstreamnt  +downstreamnt
atgaatgcacgcgaacccaacttcaccgaatcgcgcagcgcacgcctgcgccggatgctg
ctgagcaacgaactcgaattcctgatggaagcccacaacggcctgtccgcacgcatcgtg
cgcgaagccggcttcaagggcatctgggcctccggcctcgcgatctccgcgcagttcggc
gtacgcgacaacaacgaggcaagctggacgcaggtcgtcgacgtgctcgagttcatggcc
gacgcgagcgatctgccgatcctgctcgacggcgacaccggctacggcaacttcaacaac
gtgcgccgcctcgtgaagaagctcgagcagcgcggcatcgccggcgtctgcatcgaggac
aagcagttcccgaagacgaacagcttcatcgacggcgagcgccagccgctcgccgagatc
gacgaattctgcggcaagatcaaggccggcaaggattcgcagagcgaccccgacttctcg
atcgtcgcgcgcgtcgaagcgctgatcgcgggctgggggatggacgaggcgctgcgccgc
gcgaacgcctatgcggaagccggcgccgacgcgatcctgatccacagcaagctgtcgcgc
cccgacgaaatcctgcagttcgcgcgcgaatggagcggcaaggcgccgctcgtgatcgtg
ccgaccaagtactacagcacgccgaccgacgtgttccgccaggccggcatcagcaccgtg
atctgggcgaaccacctgatccgcgcgtcggcatcggcgatgcaggccgtcgcccgcgag
atccacgaaagcgaaacgctgatcaacgtcgaggatcgcgtcgcgtcggtcaacgagatc
ttccgtttgcaggacgccgacgaatactcggcggccgagcgtatctacctgtcgtcgtca
tcgcgcgcgtcgaacgcggcggtcgtgctcgccgcgagccgcggcaaggggctcgaggcc
gtcaccgaggacaagccgaaggtgatgctgcccgttgccggcaagccgctgctgcgctgg
ctcgtcgacggcttcaagaagcacggcgtgaacgacatcaccgtcgtcggcggctatcgc
gccgatgcgatcgacacgtcgggcatcaagctcgtcgtcaacgaacgccacgccgaaacg
ggcgagctcgcatcgctcgcctgcgcggccgagcgcctgaccggcgacaccgtgatctcg
tacggcgacctgctgttccgcagctacatcctgcgcgatctcgcggagagcgaggccgag
ttcagcgtcgtcgtcgattcgtcgctgaccgagccgaccaaccagagcgtgcgcgacttc
gcgttctgctcggccgccgacgaccgcgggctgttcggccagaaggtgctgctccagcgc
gtgtcgagcgatgccgccgccggcacgccgcacggccgctggatcggtctgctgaacgtg
cgcggcgccggtgtcgagcgtctgaaggcgatgctcgcgacgctgcaggcacgcgccgat
ttcgacacgctcgacatccccgcgctgctcaacgcgctgatcgccgccggcgagaagatc
gaggtgcagtacgtgcacggccactggcgcggcgtcaacgatctcgaagacttccgccgc
gcgggcgacttcgcgcacggccagacgccgatgtccgagccgggcgccggcaacgggggc
gcacgatga

DBGET integrated database retrieval system