KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04233Help
Entry
BMULJ_04233       CDS       T00740                                 

Gene name
ccpA
Definition
(GenBank) cytochrome c peroxidase
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
2:complement(1162062..1163480)
Genome map
AA seq 472 aa AA seqDB search
MTVRSAFPSPDTPGAAAPRAPFRFARRAALALGAAVIGYGAFAIAFPAHTPAAIGDVVAD
WTGANPHPIVLQRPPVQPLSAVAQLGRALFFDASLSASGKQSCASCHNPDHAYGPPNALD
VQPGGLAMTQHGYRPPPSLMYLYRQPNFSIGPDAGENDDAPSVAQQAAAAAGVVKAQKVA
GTSAAPQLVPQGGMFWDGRADTLQQQAFGPLLNPVEMANASVDEVAHKLSQSSHRTQFLQ
LFGPRVFDSPQLAVSEAMFAIARYQVEDPSFHPYNSKYDRWLEGRARLTQAELRGLRLFN
DPHKANCAGCHLSKPGADGLPPMFTDYQYEALAVPRNRQLAQNRDPAFYDLGVCGPFRED
LKDQTQYCGMFLTPTLRNAATRHVFFHNGVYHTLDQVMAFYNERSIAPQKFYARGADGKV
DQYDDIPPKYRANVDVTDAPFDRKPGDTPAMTAQDIKDIEAFLGTLTDEPAH
NT seq 1419 nt NT seq  +upstreamnt  +downstreamnt
atgacagtccgttccgcgttcccgtctcccgatacgcccggcgccgccgcgccgcgcgcc
cctttccgcttcgcacgccgcgcggcgctcgcgctcggcgcggccgtcatcggctacggc
gccttcgcgatcgcgtttcccgcgcatacgccggccgcgatcggcgacgtcgtcgcggac
tggaccggcgcgaatccgcatccgatcgtgctgcagcggccgcccgtgcagccgctgtcc
gcggtcgcgcagctcggccgcgcgctgttcttcgatgcgtcgctgtcggcgtccggcaag
cagtcgtgtgcgtcgtgccacaaccccgatcacgcctacgggccgccgaacgcactggac
gtgcagccgggcggcctcgcgatgacgcagcacggttatcggccgccgccgtcgctgatg
tatctgtatcggcagccgaacttcagcatcggccccgatgccggcgaaaacgacgacgca
ccgagcgtcgcgcagcaggcggccgcggcggccggcgtcgtgaaggcgcagaaggtggcc
ggcacgtcggccgcaccgcagctcgtaccgcaagggggaatgttctgggacggccgcgcg
gacacgctgcagcagcaggcattcggtccgctgctgaaccccgtggagatggcgaatgcg
agcgtcgacgaggtcgcgcacaagctgtcgcagtcgtcgcaccggacgcagttcctgcag
ttgttcggcccgcgcgtgttcgacagcccgcagctcgcggtgtccgaagcgatgttcgcg
atcgcgcgctatcaggtcgaggatccgtcgttccatccgtacaacagcaagtacgaccgc
tggctcgagggccgcgcgcgcctcacgcaggcggagctgcgcgggctgcggctgttcaac
gatccgcacaaggccaactgcgcgggctgtcacctgtcgaagcccggcgccgacgggctg
ccgccgatgtttaccgactaccagtacgaagcgctcgccgtgccgcgcaatcggcagctc
gcgcaaaaccgcgatccggcgttctacgatctcggcgtgtgcggaccgttccgcgaggat
ctgaaggaccagacgcaatattgcgggatgttcctgacgccgacgctgcgcaacgcggcg
acacgccacgtgttcttccacaacggcgtctatcacacgctcgatcaggtgatggcgttc
tacaacgaacgcagcatcgcgccgcagaagttctatgcgcgcggcgcggacggcaaggtc
gaccaatacgacgacattccgccgaagtaccgcgcgaacgtcgacgtgaccgacgcgccg
ttcgatcgcaagccgggcgacacgcccgcgatgacggcgcaggacatcaaggacatcgag
gcgttcctcggcacgctgaccgacgagccggcgcactga

DBGET integrated database retrieval system