KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04300Help
Entry
BMULJ_04300       gene      T00740                                 

Gene name
galM
Definition
(GenBank) galM
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:1238168..1239256
Genome map
NT seq 1089 nt NT seq  +upstreamnt  +downstreamnt
atgaccttcgataccgattcttcccgcaccgcgtccgacgtcgcccgcactccgtccgag
ccgtggggtccgctgcccggcggcgatccggtgcggcgctatacgctgcgcaacgcgcac
gggatgcgcgtcgtcgtcagcgacctcggcgcgaccgtggtgtcgtggctcgcgcccgac
cgcaccggccgcttcgccgacatcgtgctcgcgcacgacacgccggccgactatctcgcg
tccggcgcgtatctcggcgcgacggtcggccgctgggcgaaccggatcgccggcgcgcgc
ttcacgctcgacggcatcgactatccgctcgatcgcaacgagaacggcaatctgctgcac
ggcggcgcaagcggctttcatcgcgaacgctgggacgtgatcgacgatcgcggcggcctc
acgctgcggctcgattcgcccgaaggcgacgcggggtttcccggcaacgtcagcgtacaa
gtgcgctatacgctcgacgacgacggcacgctgacgatcgactacacgggcacgagcgat
gcaccgacgccgctgaacctgacgaatcacagctacttcaatctgagcggccgcgcgggc
agcgacgtgcgcggccacgtgctgaggatcgatgcggacgcgtttctcgaagtcgacgac
gcgctgattccgaccggccgcgccgacgtgacgggcaccgcgttcgatttccggcaaagc
gcgccgctcggtgcgcgcctcgattggccgcacgcgcagctcgcgcgtggccgcggcttc
gatcactgctacgtgctgcgcgacgacgtgcacggcgtgcggccggtcgcgagcatctac
gatccggaaagcggccgcgagctgaccgtgtcgaccgatcaatgcgggctgcagctctat
accggcaactatctcgacggcctgcgcgtcagcggcggcacgacctgcgtgcggcatgcg
gcgctgtgcgtcgaggccggctgctttccgaatcagatcaacatggcggagctcgctgat
gccacgatcgtacggcccggcgatacgtatcggcagacgacgcgctatcgcgtcgccgtg
cgcgcgtaa

DBGET integrated database retrieval system