KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04300Help
Entry
BMULJ_04300       CDS       T00740                                 

Gene name
galM
Definition
(GenBank) aldose 1-epimerase
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
2:1238168..1239256
Genome map
AA seq 362 aa AA seqDB search
MTFDTDSSRTASDVARTPSEPWGPLPGGDPVRRYTLRNAHGMRVVVSDLGATVVSWLAPD
RTGRFADIVLAHDTPADYLASGAYLGATVGRWANRIAGARFTLDGIDYPLDRNENGNLLH
GGASGFHRERWDVIDDRGGLTLRLDSPEGDAGFPGNVSVQVRYTLDDDGTLTIDYTGTSD
APTPLNLTNHSYFNLSGRAGSDVRGHVLRIDADAFLEVDDALIPTGRADVTGTAFDFRQS
APLGARLDWPHAQLARGRGFDHCYVLRDDVHGVRPVASIYDPESGRELTVSTDQCGLQLY
TGNYLDGLRVSGGTTCVRHAALCVEAGCFPNQINMAELADATIVRPGDTYRQTTRYRVAV
RA
NT seq 1089 nt NT seq  +upstreamnt  +downstreamnt
atgaccttcgataccgattcttcccgcaccgcgtccgacgtcgcccgcactccgtccgag
ccgtggggtccgctgcccggcggcgatccggtgcggcgctatacgctgcgcaacgcgcac
gggatgcgcgtcgtcgtcagcgacctcggcgcgaccgtggtgtcgtggctcgcgcccgac
cgcaccggccgcttcgccgacatcgtgctcgcgcacgacacgccggccgactatctcgcg
tccggcgcgtatctcggcgcgacggtcggccgctgggcgaaccggatcgccggcgcgcgc
ttcacgctcgacggcatcgactatccgctcgatcgcaacgagaacggcaatctgctgcac
ggcggcgcaagcggctttcatcgcgaacgctgggacgtgatcgacgatcgcggcggcctc
acgctgcggctcgattcgcccgaaggcgacgcggggtttcccggcaacgtcagcgtacaa
gtgcgctatacgctcgacgacgacggcacgctgacgatcgactacacgggcacgagcgat
gcaccgacgccgctgaacctgacgaatcacagctacttcaatctgagcggccgcgcgggc
agcgacgtgcgcggccacgtgctgaggatcgatgcggacgcgtttctcgaagtcgacgac
gcgctgattccgaccggccgcgccgacgtgacgggcaccgcgttcgatttccggcaaagc
gcgccgctcggtgcgcgcctcgattggccgcacgcgcagctcgcgcgtggccgcggcttc
gatcactgctacgtgctgcgcgacgacgtgcacggcgtgcggccggtcgcgagcatctac
gatccggaaagcggccgcgagctgaccgtgtcgaccgatcaatgcgggctgcagctctat
accggcaactatctcgacggcctgcgcgtcagcggcggcacgacctgcgtgcggcatgcg
gcgctgtgcgtcgaggccggctgctttccgaatcagatcaacatggcggagctcgctgat
gccacgatcgtacggcccggcgatacgtatcggcagacgacgcgctatcgcgtcgccgtg
cgcgcgtaa

DBGET integrated database retrieval system