KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04616Help
Entry
BMULJ_04616       CDS       T00740                                 

Definition
(GenBank) bacteriophage lysozyme
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
Position
2:complement(1623951..1624448)
Genome map
AA seq 165 aa AA seqDB search
MADVPKKTLVSVVGAAAAALLFSIVPKFEGLELVARPDPIGIITACNGDTKDVRAGQRFT
PDECRARLEQRLIEHAEPVLKCTPSLKGHTYQLAAAVSFAYNVGSGAYCSSTTAKRFNSG
DWKGACRALNEADNGRPQWVTAGGRVLPGLVKRRAEERALCERGL
NT seq 498 nt NT seq  +upstreamnt  +downstreamnt
atggctgacgtgccgaagaagacgcttgtgagcgttgttggggctgctgcggcagccctt
cttttttctatcgtgccgaagttcgaggggctcgagctcgtcgcgcggccggacccgatc
gggatcatcacggcctgcaatggcgacacgaaggacgtgcgcgccggccagcgcttcacg
ccggatgagtgccgcgcgcgcctggagcaacgtctgatcgagcacgcggagcccgtgctg
aagtgcacgccgagcctgaagggccacacgtaccagctcgcggccgccgtgagcttcgca
tacaacgtcggcagcggtgcgtactgcagcagcacaacggcgaagcggttcaactccggc
gactggaagggcgcgtgccgtgcgctcaacgaggccgacaacggccggccgcagtgggtc
acggccggcggccgcgtgctgcccggactggtgaaacggcgagctgaggagcgcgcactg
tgcgagcgggggctgtga

DBGET integrated database retrieval system