KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04720Help
Entry
BMULJ_04720       gene      T00740                                 

Gene name
pyrB
Definition
(GenBank) pyrB
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:1694898..1696193
Genome map
NT seq 1296 nt NT seq  +upstreamnt  +downstreamnt
atgcccgttcctcagcaagccttcctccgcgacgcgatgcgccgcctcaacatgacgcgc
gaagcgttcgcgaaccgcatcggcgtgagccgccgtgcgctagatacctggctgctaccc
gacgattcgcaggaatcgcgcggcatgccggagatcgtcgagcggttcgtgtcggagatc
gtcgagcgcgcggcgccggaaggcgaaatctatacgcaacgcgtagataaccacggcctc
gcgaagcagttcctgttcgaaggcaagccgcaactgctgtcggtcgaccagttctcgcgc
gagtcggtcgaggcgctgttccgcgtcgccgacgtgatgcagccgatcgcgcgccgccac
aagatttcgcgcgtgctcgaaggcgcggtgctcggcaacctgttcttcgaagccagcacg
cgcacgcgcgtgtcgttcggcgcggcgttctgccggctcggcggctccgtctgcgacacg
accgggttcacgttctcgtcgatggcgaaaggcgagtcgatctacgatacgagccgcgtg
atggccggctacgtcgacgcgctcgtgatccgccatccggagaaaggctcggtcgccgaa
ttcgcgcgcgcgaccaatctgccggtgatcaacggcggcgacggtccgggcgagcatccg
agccaggcgctgctcgatctctatacgatccagcgcgaattctcgcggctcggcaagatc
gtcgacggcgcgcacatcgcgctcgtcggcgacctcaaatacggccggaccgtgcattcg
ctcgtcaagctgctcgcgctctaccgcgggctcaaattcacgctggtgtcgccgccgacg
ctcgaaatgcccgcctacatcatcgaccagatcgcgacgaacgggcacgtgatcgagcag
acgaacgacctcgcggcggggctgcgcggcgccgatgtcgtctatgcgacgcgaatccag
aaggagcgcttcaccgacgagtcgttcgaaggctatacgcccgatttccagatcaatcag
gcgctcgtcgacacggtctgcaaacccgacacgctgatcatgcatccgctgccgcgcgac
agccggcccggcgccaacgatctgtcgaccgacctgaaccgcgatccgcgtctcgcgatc
ttccggcagaccgacaacggcattccggtgcgcatggcgatctttgccgtgctgctcggc
gtcgaaaacctcgtgcagcattcgatgcgcgacgcgacgtggcgaccgccggcatacctg
gggccggaggatgccgtgtttcacgggatcgactga

DBGET integrated database retrieval system