KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04765Help
Entry
BMULJ_04765       gene      T00740                                 

Gene name
asnB
Definition
(GenBank) asnB
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(1756907..1758874)
Genome map
NT seq 1968 nt NT seq  +upstreamnt  +downstreamnt
atgtgcggaatcgacggctttctgaatagcgtcgccttcgatgaggagacagcgcgcggc
acgctcgcgcggatgacggcgagcctcgcgcatcgcggaccggacgcacagggcttgtgg
gtcgatccggcggccggtatcgcgctcggtcaccggcggctcgcgatcgtcgacctgtcg
gtgcacggccggcagccgatggcgtcggcgtgcggccgctacgtgatggtcttcaacggc
gagatctacaaccaccgcgaactgcgcgcgcagctcgagcgcgtcggacgcgcgcccgcg
tggcgcggtcattccgacaccgaagtgctgctcgccgcgttcgccgcgtggggcgtcgac
gcgacgttgcggcgcgcgaccgggatgttcgcgctcgcgctgtggaaccgcgagtcgcgc
gtgctgacgctcgcgcgcgaccgcatcggcgagaaaccgctgtattacgggcggatcggc
gatgcgctcgtattcgcgtcggagctgaaggcgctgcgcgcctatccggggttcgacggc
gagatcgatcgcgacgcgctgtgcctgtatctgcggcattccgcggtgcccgcgccgcat
acgatctatcgcggcatccgcaagttgccgcccggcagctggatccagttcgagcatgcg
caggacacgccgcgaatccgcacgtactgggcgctcgagcacgccatcgatgccggccat
cacgagccgttcgcaggcaccgcggccgaggccgtcgaccggctcgacacggtgctgcgg
caggccgtcgcgcggcagatggaagccgacgtgccgctcggcgcgttcctgtcgggcggc
gtcgattcgtcgacgatcgtcgcgctgatgcaggcgcagtccgccgcgcccgtcgacacg
ttcacgatcggttttcacgaagcgggctacgacgaggccggctatgcgaaggccgtcgcg
cgccatctcggcacgcgccataccgagctgtacgtgacggccgatcatgcgctcgacgtc
gtgccgaagctgccggccatctacgacgagccgttctccgacgcgtcgcagattccgacc
ttcctcgtcgcggaactgacgcgccggcacgtgaaggtcagcctgtccggcgacggcggc
gacgagctgttcggcggctatacgcgctacttcctgacgccgcgcctctggcgcaagctg
catcgcgtgccggcggccgtgcgtacgcggatcgccggcgcgctgcacgcgctgcgaccc
gatcatgcggaccagctcgcggctgtcgcgcaaggcgcgtggggcggcggcgaactgcgc
gaatcggcgacgcgcatcggcgaccggctgcacaagctcggccacgtgatgacggccgac
agccggatcgggctgtaccggctgctgatgtcgtcggtccatcatccggagcgcatcgcg
ctcgccgggcacgagccgccgacgccgctcgatacggtatccgcatggcccgcgcatctg
agctttgccgagcaggcgatggcgatcgacacgctcacctatctgccgaccgacatcctg
acgaaggtcgaccgcgcggcgatggcggtcagcctcgaaacgcggatgccgttcctcgat
catcacgtcgtcgaattcgcgtggcggctgcccgcatcgctgcgcttgcccgaagggcag
tcgaaggcgctgctgcgccggctgctcgaccggtacgtgccgaccgagctgatcgaccgg
ccgaagcagggcttctgcgcgccgatcgatcactggctgcgcggcgcgctgcgcgactgg
gccgacgcgttgctgcagccgtcgcggctgcgcgacgagggcttcttcgacgcggccgcg
gtcgagcggctgtggcgccagcatcagacggggcgcatgaactggcagcatcagctgtgg
accgtgctgatgttccaggcgtggctcgacgcgcagcgcgccgcctga

DBGET integrated database retrieval system